View an NMR Structure from the Turner Lab

r(5'GGAGUGGCCGAAAGGCAUCUCC3')

N. Shankar, T. Xia, S. D. Kennedy, T. R. Krugh, D. H. Mathews and D. H. Turner, Biochemistry, 46, 12665-78 (2007).

2JSE

Abstract

r(5'GC(iG)GA(iC)GCA3')

2O81

Abstract

r(5'GG(iC)GA(iG)CCA3')

G. Chen, R. Kierzek, I. Yildirim, T. R. Krugh, D. H. Turner, and S. D. Kennedy, J.Phys.Chem. B 111 6718-6727 (2007).

2O83

r(5'GCUGAGGCU3')

2IRN

Abstract

r(5'GCGGAUGCU3')

B. S. Tolbert, S. D. Kennedy, S. J. Schroeder, T. R. Krugh, and D. H. Turner, Biochemistry 46 1511-22 (2007).

2IRO

r(5'GGCUAAGAC3'):r(5'GUCGAAGCC3')

N. Shankar, S. D. Kennedy, G. Chen, T. R. Krugh, and D. H. Turner, Biochemistry, 45, 11776-89 (2006).

2H49 Abstract

r(5'GGUGGAGGCU3'):r(3'PCCAAAGCCG5')

2DD1

Abstract

An alternating sheared AA pair in 5'GGUGAAGGCU/3'PCCGAAGCCG: I. The major conformation with A6/A15/A16 stack

2DD2

An alternating sheared AA pair in 5'GGUGAAGGCU/3'PCCGAAGCCG: II. The minor conformation with A6/A5/A16 stack

G. Chen, S. D. Kennedy, J. Qiao, T. R. Krugh, D. H. Turner, Biochemistry, 45, 6889-6903 (2006).

2DD3

Sheared GA Pairs in r(5'GGUGGAGGCU3'):r(3'PCCGAAGCCG5')

G. Chen, B. M. Znosko, S. D. Kennedy, T. R. Krugh, D. H. Turner, Biochemistry, 44, 2845-2856 (2005).

1XV0 Abstract

r(5'GAGGAAGGCGA3'):r(5'UCGUUAAUCUC3')

B. M. Znosko, S. D. Kennedy, P. C. Wille, T. R. Krugh, D. H. Turner, Biochemistry, 43, 15822-15837 (2004).

1TUT Abstract

d(5'CCUCCUU3'):r(3'AGGAGGAAA5')

1NTQ

Abstract

d(5'CCpUpCpCpUpUp3'):r(3'AGGAGGAAA5') with 1-propynylation at C5 of oligopyrimidines

1NTS

d(5'CpCpUpCpCpUpUp3'):r(3'AGGAGGAAA5') with 1-propynylation at C5 of oligopyrimidines

B. M. Znosko, T. W. Barnes, III, T. R. Krugh, and D. H. Turner, J. Am. Chem. Soc., 125, 6090-6097 (2003).

1NTT

The tandem, sheared PA pairs in r(5'GGCPAGCCU3')2

1MV1

Abstract

The tandem, Face-To-Face AP pairs in r(5'GGCAPGCCU3')2

1MV2

The tandem, sheared PP pairs in r(5'GGCPPGCCU3')2

B. M. Znosko, M. E. Burkard, T. R. Krugh, and D. H. Turner, Biochemistry, 41, 14978-14987 (2002).

1MV6

Sheared AantiĽAanti base pairs in r(5'GGCAAGCCU3')2

B. M. Znosko, M. E. Burkard, S. J. Schroeder, T. R. Krugh, and D. H. Turner, Biochemistry, 41, 14969-14977 (2002).

1MUV

Abstract

Structure of RNA duplex containing Isoguanosine and Isocytidine r(5'CiGCGiCG3')2

X. Chen, R. Kierzek, and D. H. Turner, J. Am. Chem. Soc., 123, 1267-1274 (2001).

1G3A

Abstract

The G7 syn, G4 anti GG pair in r(5'GCAGGCGUGC3')2 

1F5G

Abstract

The G4 syn, G7 anti GG pair in r(5'GCAGGCGUGC3')2

M. E. Burkard and D. H. Turner, Biochemistry, 39, 11748-11762 (2000).

1F5H

Two hydrogen bonds for each GU pair in r(5'GAGUGCUC3')2

1EKA

Abstract

One hydrogen bond for each GU pair in r(5'GGCGUGCC3')2

X. Chen, J. A. McDowell, R. Kierzek, T. R. Krugh, and D. H. Turner, Biochemistry, 39, 8970-8982 (2000).

1EKD

Tandem wobble GU pairs in r(5'GGAGUUCC3')2

1QES

Abstract

Tandem wobble GU pairs in r(5'GGAUGUCC3')2

J. A. McDowell, L. He, X. Chen, and D. H. Turner, Biochemistry, 36, 8030-8038 (1997).

1QET

Imino hydrogen bonded GA pair in r(5'GGCAGGCC3')2

M. Wu, J. SantaLucia, Jr., and D. H. Turner Biochemistry, 36, 4449-4460 (1997).

1MWG

Abstract

Tandem wobble GU pairs in r(5'GAGGUCUC3')2

J. A. McDowell and D. H. Turner, Biochemistry, 35, 14077-14089 (1996).

1GUC

Abstract

Imino hydrogen bonded GA pair in r(5'GCGGACGC3')2

1MIS

Abstract

M. Wu and D. H. Turner, Biochemistry, 35, 9677-9689 (1996).

Six-nucleotide ribosomal hairpin loop: r(5'GGCGUAAUAGCC3')

M. A. Fountain, M. J. Serra, T. R. Krugh, and D. H. Turner, Biochemistry, 35, 6539-6548 (1996).

local

Abstract

Sheared GA pair in r(5'GGCGAGCC3')2

J. SantaLucia, Jr. and D. H. Turner, Biochemistry, 32, 12612-12623 (1993).

1YFV

Abstract

 

[Home] - [Object] - [NMR Structure] - [RNAstructure] - [Dynalign] - [Members] - [Former Members] - [Publication]